Best writers. Best papers. Let professionals take care of your academic papers

Order a similar paper and get 15% discount on your first order with us
Use the following coupon "FIRST15"
ORDER NOW

2) The following is a segment of Genghis Khan’s Y-chromosome DNA that includes the promoter sequence and transcription start site of one of his genes (the sequence is easy to get because he is responsible for 0.5 percent of the male population in the world, or roughly 16 million descendants living today. In other words, one out of every 200 men alive have this exact same DNA sequence): 5’AGTATATATTCACGATGGAACGACTATCCTGACGTTACCCGACATAGTGACGACGGCATTCGATAT 3′ 3’TCATATATAAGTGCTACCTTGCTGATAGGACTGCAATGGGCTGTATCACTGCTGCCGTAAGCTATA 5′ a. Which strand (upper or lower) is most likely the template strand for the gene?

2) The following is a segment of Genghis Khan’s Y-chromosome DNA that includes the
promoter sequence and transcription start site of one of his genes (the sequence is easy to
get because he is responsible for 0.5 percent of the male population in the world, or roughly
16 million descendants living today. In other words, one out of every 200 men alive have this
exact same DNA sequence):
5’AGTATATATTCACGATGGAACGACTATCCTGACGTTACCCGACATAGTGACGACGGCATTCGATAT 3′
3’TCATATATAAGTGCTACCTTGCTGATAGGACTGCAATGGGCTGTATCACTGCTGCCGTAAGCTATA 5′
a. Which strand (upper or lower) is most likely the template strand for the gene?

 
Looking for a Similar Assignment? Order now and Get 10% Discount! Use Coupon Code "Newclient"