why would an apparently intelligent man such as captain Beatty
Question why would an apparently intelligent man such as captain Beatty support a society that burns books
What does this quote mean?”He has waged cruel war against
Question What does this quote mean?”He has waged cruel war against human nature itself, violating its most sacred of rights of life and liberty in the persons of a distant people who never offended him, captivating and carrying them into slavery in another hemisphere, or to incur miserable death in their transportation thither.”
How did writers use gothic writing during this time period?
Question How did writers use gothic writing during this time period? What topics did they explore and why?What is manifest destiny according to the film? And what affect did this have on the American people?What American fears did Melville expose in Moby Dick?How is Emily Dickinson’s work linked to the Gothic genre?What traditional conventions did Hawthorne, Melville, and Dickinson challenge?
GTGGTATTATCGCTGGTAATGCCCGCC For this strand of template DNA, list a. the
Question GTGGTATTATCGCTGGTAATGCCCGCC For this strand of template DNA, list a. the complementary strand of DNA b. the RNA strand produced c. the anticodons in order d. Then, list the amino acids produced in order.
will select a theme and six works of art for
Question will select a theme and six works of art for the Course Project, Art Appreciation Gallery. will carry this theme throughout the course and additions for each unit will all relate back to this selected theme. Be creative in theme selection. can select a historical period or a type of art. It can be modern or traditional. To select a theme, review the course content and the textbook, and do some research using the Internet. Select a theme that interests , one that would be interested in learning more about. Once have a theme selected, select six works of art that fall under that theme. can use multiple works of art created by the same artist. Begin with the PowerPoint template provided under the Course Resources tab. Be sure to add your own creative elements, including the background and graphics. may also add more slides. For this portion of the presentation, should be at least nine slides of the template that include the following: Title slide: Include the title of presentation, your name, your instructor’s name, and the date. Introduction slide 1: Include the title of your theme and a brief overview. Introduction slide 2: Include why this theme interests you and what you hope to learn. Artwork slides: Complete the six artwork slides, including each work’s title, author, date, and characteristics. Use the basic tools of visual analysis when describing each work, and include a visual of the artwork if possible.
Compare and Contrast Walt Whitman and Emily Dickinson’s faith or
Question Compare and Contrast Walt Whitman and Emily Dickinson’s faith or religion.
I just want the tutor to double check and make corrections to
I just want the tutor to double check and make corrections to the outline and research if need it. About this paper depends my grade.
Think of a piece of fiction you read that had an impact
Think of a piece of fiction you read that had an impact on you. And write a one paragraph summary of the text. Then write a one sentence summary of the situation in which you read the text (the context)
this is the link for pdf version (http://ebooksmadefree.weebly.com/uploads/5/4/8/2/54824347/cujo.pdf) We will have a
this is the link for pdf version (http://ebooksmadefree.weebly.com/uploads/5/4/8/2/54824347/cujo.pdf) We will have a response post every week, due Sunday 11:59. These will either be open-ended, in which case you can respond to anything we covered in class that week, or prompted, in which case I gently direct you to focus on a particular subject. In this case, Cujo 1-140. Each Response should contain 3 quotes that you liked; anything about the text that confuses you; and a 150 word reflection on a theme, character, reference, or event in the reading that strikes you. Then reply to 3 of your colleagues by the following Tuesday. For example, mine might look like this: “Cujo lay on the floor of the garage, in semi-gloom” (88)”Men know what they are. They have an image of what they are. The never live up to the ideal, and it breaks them, and maybe that’s why so many men die unhappy and before their time” (117) “He had replaced the morphine he could no longer obtain with high-tension booze and had then proceeded to get about his life’s work, which was killing himself as slowly and pleasantly as possible” (44)What is with all the honeysuckle references? Does honeysuckle mean something to you guys? Does the cereal really matter or just a device to get Dad out of town? WHY DOES IT START LIKE A FAIRY TALE?As he suggests in IT, The Dead Zone, Christine, and numerous other stories, in Cujo Stephen King attempt to demonstrate that evil is an abstract, nebulous force that floats from time and place to time and place, manifesting in various ways. He writes, describing the death of Frank Dodd in The Dead Zone: “the monster never dies. Werewolf, vampire, ghoul, unnameable creature from the wastes [IT?]. The monster never dies. IT came to Castle Rock again in the summer of 1980” (4). As the novel develops, characters from the Monster In the Closet to Cujo to the Drunk Asshole to Steve Kemp share traits associated with monsters, as though evil is something that, the more we try to repress it or hide it, the more strongly it will emerge. This reminds me of the subconscious psychology advanced by Freud, where every painful emotional we suppress, will still manifest in other areas of our lives, as alcoholism, as domestic abuse, of violence, as adultery, as generalized anger dispersed into a legion of monsters. Cujo is just one among many in the novel, and probably the least important.
Write specific points and explain from the book LIGHT A CANDLE OR CURSE THE DARKNESS
In the attachments there is an example of the paper. The attachments also have pictures of the book and pages that must be used to do this assignment. No outside sources must be used. There must be only one reference and that is “Morse, Jon and Mary. (2008) Light a candle or curse the darkness: How to connect with America’s youth. United States of America: SSU Publications.” You must pick a quote from the book. Then write a question that must be two paragraphs. Then find 5 talking points form the book and elaborate on them. the assignment must be a full 4 pages not including the bibliography. One page is for the quote and the other 3 are for the actual writing. The wanted length of each section can be seen in the example given in the files. The sample is only supposed to be used as an example. No information from the sample must be copied or used. Thank you.
1. Where is Esmeralda’s family living? 2. How would you
Question 1. Where is Esmeralda’s family living? 2. How would you describe Mami and Papi’s relationship based on the new information revealed in this chapter? 3. How does Mami feel about Macún? 4. How would you describe Mami in her relationship with Papi? 5. How would you describe Mami when she leaves Papi? 6. What lessons does Santiago learn at school? 7. How are the children socialized? 8. How do they learn to categorize other people?
List three difficulties Bradford and his group encountered upon landing
Question List three difficulties Bradford and his group encountered upon landing
What is the theme of “One Hour” by Dashiell Hammett
Question What is the theme of “One Hour” by Dashiell Hammett in one sentence?Short story link: http://fullreads.com/literature/one-hour/
Identify the plot of the play style=”background-color:rgb(252,252,252);color:rgb(51,51,51);”>’Amadeus’ and 3 characters.Choose
Question Identify the plot of the play style=”background-color:rgb(252,252,252);color:rgb(51,51,51);”>’Amadeus’ and 3 characters.Choose 2 scenes from the play. Describe in detail what you see.List and describe each character.List one line spoken by one of the characters and describe how the others in the scene react to what is said. Describe your overall reaction after viewing the play.
Maaari po bang magpagawa ng sanaysay patungkol sa temang “Katutubong
Question Maaari po bang magpagawa ng sanaysay patungkol sa temang “Katutubong wika tungo sa nagkakaisang Pilipinas”
In the Immortal Life of Henrietta Lacks, give an example
Question In the Immortal Life of Henrietta Lacks, give an example (a quote) in which Skloot’s diction is abstract and explain how she uses it to further her ideas in the book.
About halfway through the chapter”On the Rainy River,” in the
Question About halfway through the chapter”On the Rainy River,” in the book The things they carried the narrator begins referring to the reader as you. Consider, for example, the repeated references and questions to you on page 56. What effect does this sudden occurrence of direct address have on the reader?
Using t Test and ANOVA With Sun Coast Remediation Data
Question Using t Test and ANOVA With Sun Coast Remediation Data SetUsing the Sun Coast Remediation data set, perform an independent samples t Test, dependent samples t Test, and ANOVA, and interpret the results.You will utilize Microsoft Excel Toolpak for this assignment.Example:
Create a PowerPoint presentation for the Sun Coast Remediation research
Question Create a PowerPoint presentation for the Sun Coast Remediation research project to communicate the findings and suggest recommendations. Please use the following format:Slide 1: Include a title slide.Slide 2: Organize the agenda.Slide 3: Introduce the project.Statement of the ProblemsResearch ObjectivesSlide 4: Describe information gathered from the literature review.Slide 5: Include research methodology, design, and methods.Research MethodologyResearch DesignResearch MethodsData collectionSlide 6: Include research questions and hypothesesSlides 7 and 8: Explain your data analysis.Slides 9 and 10: Explain your findings.Slide 11: Explain recommendations including an explanation of how research-based decision-making can directly affect organizational practices.Slide 12 and 13: Reflect on your experience throughout the course. Provide some of the things you learned and some of the course’s takeaways that you can apply to your current or future job.Slide 14: Include references for your sources.Your PowerPoint must be a minimum of fourteen slides in length (including the title slide and a reference slide).You are required to narrate your presentation. Utilize the note section to write out your transcript per slide. Ensure the presentation you create is your own authentic work. Ensure that you follow APA guidelines and cite any resources you use. For assistance with adding narration to your presentation, click here for an instructional document.ResourcesThe following resource(s) may help you with this assignment.
Comparing Walt Whitman to Emily Dickenson; who is more ‘romantic’?
Question Comparing Walt Whitman to Emily Dickenson; who is more ‘romantic’?
This question was created from _study_guide_questions_h2rllap.docx https://www.coursehero.com/file/28643576/-study-guide-questions-h2rllapdocx/ not sure how
Question This question was created from _study_guide_questions_h2rllap.docx https://www..com/file/28643576/-study-guide-questions-h2rllapdocx/ not sure how to asnwer this question. ATTACHMENT PREVIEW Download attachment 28643576-337460.jpeg (311.19 pgs.163-174 “Geography Matters…
The post why would an apparently intelligent man such as captain Beatty appeared first on Smashing Essays.